Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circ_0001204 | |||
Gene | DGCR8 | Organism | Human |
Genome Locus | chr22:20070853-20070981:+ | Build | hg19 |
Disease | Tuberculosis | ICD-10 | Respiratory tuberculosis, bacteriologically and histologically confirmed (A15-A19) |
DBLink | Link to database | PMID | 29057952 |
Experimental Method | |||
Sample Type | Peripheral blood samples | Comparison | 96 patients with active pulmonary TB and 85 healthy controls |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward GCTTATAGAGGGGAGGAAGGAAC ReverseCATCCTAGATGCTACAGACACAA | Statistics | Fold Change : Downregulated pvalue : p=0.0000164596 |
Citation | |||
Huang, Z, Su, R, Deng, Z, Xu, J, Peng, Y, Luo, Q, Li, J (2017). Identification of differentially expressed circular RNAs in human monocyte derived macrophages response to Mycobacterium tuberculosis infection. Sci Rep, 7, 1:13673. |